LightSwitch miRNA Mimics and Inhibitors Inhibitors
LightSwitch miRNA inhibitors are chemically optimized synthetic RNAs that are used to knock down the expression endogenous human miRNAs in living cells. A LightSwitch miRNA inhibitor can be transfected into cells to study the effects of the loss of function of a miRNA of interest. LightSwitch miRNA inhibitors have been fully optimized for use with LightSwitch 3’UTR GoClone reporters.
Find your miRNA inhibitor of interest by clicking on the list below:
miR-1..99 | miR-100..199 | miR-200..299 | miR-300..399 | miR-400..499 | miR-500..599 | miR-600..699 | miR-700..999 | miR-1000..2300 | let-7
LightSwitch miRNA mimic non-targeting controls
| Prod ID | miRNA control | Sequence | Inventory | Price | |
| INH9001 | Non-targeting_1 | UCACAACCUCCUAGAAAGAGUAGA | 5-7 days |  |
|
| INH9002 | Non-targeting_2 | UUGUACUACACAAAAGUACUG | 5-7 days | |