3’UTR Reporter Vector

Prod ID Type Amount Price  
S890005 EMPTY_3UTR 5ug FREE*

Add to Cart


 

Empty 3'UTR Reporter VectorFragments cloned into the MCS downstream of the reporter gene will become part of a hybrid transcript that contains the luciferase coding sequence fused to the UTR sequence of interest. Standard 3’UTR-reporter products include 200bp-3kb human 3’UTR fragments cloned into the MCS.

View the vector sequence and annotation file (txt)

3’UTR Insert Sequencing Primers:

Forward: GGGAAGTACATCAAGAGCTTCGT

Reverse: CCCCCTGAACCTGAAACATAAA

* One free empty vector construct (5ug) with any purchase