Vector Information

Promoter Reporter Vector:

Prod ID Type Amount Price  
S790005 EMPTY_PROM 5ug FREE*

Empty Promoter VectorFragments may be cloned into the MCS to measure promoter activity. Standard promoter-reporter products include 1-3kb of human promoter sequence cloned into the MCS.

View the vector sequence and annotation file (txt)

Promoter Insert Sequencing Primers:

Forward: TCCATCAAAACAAAACGAAACAA

Reverse: AGTCGAGCACGTTCATCTGCTT


3′UTR Reporter Vector:

Prod ID Type Amount Price  
S890005 EMPTY_3UTR 5ug FREE*

Empty 3'UTR Reporter VectorFragments cloned into the MCS downstream of the reporter gene will become part of a hybrid transcript that contains the luciferase coding sequence fused to the UTR sequence of interest. Standard 3’UTR-reporter products include 200bp-3kb human 3’UTR fragments cloned into the MCS.

View the vector sequence and annotation file (txt)

3’UTR Insert Sequencing Primers:

Forward: GGGAAGTACATCAAGAGCTTCGT

Reverse: CCCCCTGAACCTGAAACATAAA


5′UTR Reporter Vector:

Prod ID Type Amount Price  
S690005 EMPTY_5UTR 5ug FREE*

Empty 3'UTR Reporter VectorFragments cloned into the MCS upstream of the reporter gene will become part of a hybrid transcript that contains the UTR sequence of interest fused to the luciferase coding sequence.

View the vector sequence and annotation file (txt)

5’UTR Insert Sequencing Primers:

Reverse: AGTCGAGCACGTTCATCTGCTT

 


Long-range Enhancer Reporter Vector:

Prod ID Type Amount Price  
S990005 EMPTY_LR 5ug FREE*

Empty 3'UTR Reporter VectorLong-range transcriptional elements may be cloned into the MCS that is immediately upstream of a basal TK promoter to measure changes in transcriptional activity.

View the vector sequence and annotation file (txt)

LR Insert Sequencing Primers:

Forward: TCCATCAAAACAAAACGAAACAA

Reverse: AGTCGAGCACGTTCATCTGCTT


* One free empty vector construct (5ug) with any purchase