Lightswitch miRNA Mimics and Inhibitors

LightSwitch miRNA mimics are chemically optimized synthetic double-stranded RNAs that act as functional equivalents to endogenous human miRNAs. A LightSwitch miRNA mimic can be transfected into cells to study the effects of over-expression of a miRNA of interest. LightSwitch miRNA mimics have been fully optimized for use with LightSwitch 3’UTR GoClone reporters.

Find your miRNA mimic of interest by clicking on the list below:

miR-1..99 | miR-100..199 | miR-200..299 | miR-300..399 | miR-400..499 | miR-500..599 | miR-600..699 | miR-700..999 | miR-1000..2300 | let-7

LightSwitch miRNA mimic non-targeting controls

Prod ID miRNA control Sequence Inventory Price  
MIM9001 Non-targeting_1 UCACAACCUCCUAGAAAGAGUAGA 5-7 days 5nmol ($160)
Add to Cart
MIM9002 Non-targeting_2 UUGUACUACACAAAAGUACUG 5-7 days 5nmol ($160)
Add to Cart

Click here to browse miRNA inhibitors
Product information sheet