5′UTR Reporter Vector
| Prod ID | Type | Amount | Price | |
| S690005 | EMPTY_5UTR | 5ug | FREE* |
Fragments cloned into the MCS upstream of the reporter gene will become part of a hybrid transcript that contains the UTR sequence of interest fused to the luciferase coding sequence.
View the vector sequence and annotation file (txt)
5’UTR Insert Sequencing Primers:
Reverse: AGTCGAGCACGTTCATCTGCTT
* One free empty vector construct (5ug) with any purchase